Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD53YM17FM1
Length(NT) : 424
Best Gene Model Blast : Link to GSTUMT00004791001 E-value : 1e-151
Numbers of ESTs : 1

Blast Results:

Nr Definition: peptide methionine sulphoxide
Accession: ref|XP_001560063.1| Score: 382 E_value: 1e-35
KEGG Definition: hypothetical protein [EC:1.8.4.11]; K07304 peptide-methionine (S)-S-oxide reductase
Accession: mgr:MGG_04243 Score: 362 E_value: 1e-33
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG1635 Score: 297 E_value: 3e-28
PFAM Definition: PMSR, Peptide methionine sulfoxide reductase. This enzyme repairs damaged proteins. Methionine sulfoxide in proteins is reduced to methionine..
Pfam Number: pfam01625 Score: 316 E_value: 1e-30
Swissprot: O83641|MSRAB_TREPA
Gene Ontology:
GO:0033743 = Molecular function: peptide-methionine (R)-S-oxide reductase activity
GO:0008113 = Molecular function: peptide-methionine-(S)-S-oxide reductase activity
GO:0006464 = Biological process: protein modification process

Sequence:
>SY0AAD53YM17FM1
TTGGGGGGACAACTTTGTACAAAAAAGTTGGGGAATCCTCTCCTTCTTCC
TCCTAACGCTCACGACAACGTTAATGTTCACATCTCTCCTCCCTCGCTTC
TTCCGCCTCTTCTCAGCCAGCAAATTCACCTTGGGTCCTCTCGGCGGCAA
CATGTCCCTCCCGGAGACCACCGAAAAAGCAACATTCGCCGCTGGGTGCT
TCTGGGGTGTCGAACATCTCTTCCGCAAACACTTTACAGGCAAAGGCCTG
TTGGATGCTCGAGTCGGCTACATAGGTGGGGACACCGCACACCCAACCTA
CCGTTCCGTTTGTTCCGGGACAACCGGCCATGCCGAGGCGCTCCAAGTTC
TCTATAACCCTTCAGAAGTCACCTACGAGAAATTTCTAGAATTCTTCTTC
CAGATGCACGACCCAACAACGGTG

Sequences in the Contig:

SY0AAD53YM17FM1