Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD53YM12FM1
Length(NT) : 524
Best Gene Model Blast : Link to GSTUMT00006226001 E-value : 5e-71
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001244060.1| Score: 202 E_value: 6e-31
KEGG Definition: hypothetical protein; K02998 small subunit ribosomal protein SAe
Accession: ani:AN3172.2 Score: 195 E_value: 9e-31
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG0830 Score: 175 E_value: 6e-14
PFAM Definition: Ribosomal_S2, Ribosomal protein S2..
Pfam Number: pfam00318 Score: 127 E_value: 2e-08
Swissprot: Q01291|RS0_NEUCR

Sequence:
>SY0AAD53YM12FM1
TTGGTCCCTACCAACCGCGAGGGATCACGAACCAAGGTCCCACTATCGAA
AAACCTGAACAATATGGCTCCTACTACTACAAACCTTTTTGATGCGACAA
CCCAGGACATAGAGATGCTCCTGGCTGCTCAGGCTCATATAGGAGCAAAA
AACTTGCAGGTCGGTCCTTGTGGACTCGCGGTTTCTACGGCTTTAGAGTA
CCTGTACTAATTGGAACCCGGACAGGTTCACATGGACCCCTACGTCTGGA
AGACGAGACCTGATGGTGTAAACATTATCAACATCGGAAAGACCTGGTGA
GTGCAATTGCAAAACCTTAATCTTTGCTCTCTGGGATCGGCCTCCTTGTC
GCTATCTAAACTTGGCTACATTTTTCTAACATCGAAGGTAGGGAGAAGAT
TGTTCTTGCTGCTCGTATTATCGCTACTATTGACAACCCAGCCGATGTCT
GTGCTGTGTCCGCCCGCTCTTTCGGTCAGCGTGCCGTCTTGAAGTTCGCC
ACTCACACCGGCGCAACTGCTATT

Sequences in the Contig:

SY0AAD53YM12FM1