Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD53YI09FM1
Length(NT) : 567
Best Gene Model Blast : Link to GSTUMT00004199001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: rhamnogalacturonase rhgA-Aspergillus niger emb|CAK41025.1| rhamnogalacturonase rhgA-Aspergillus niger
Accession: ref|XP_001395184.1| Score: 463 E_value: 8e-45
KEGG Definition: rhgA; rhamnogalacturonase rhgA-Aspergillus niger [EC:3.2.1.15]; K01184 polygalacturonase
Accession: ang:An12g00950 Score: 463 E_value: 4e-45
KOG Definition: No Hit Found
PFAM Definition: Glyco_hydro_28, Glycosyl hydrolases family 28. Glycosyl hydrolase family 28 includes polygalacturonase EC:3.2.1.15 as well as rhamnogalacturonase A(RGase A), EC:3.2.1.-. These enzymes is important in cell wall metabolism..
Pfam Number: pfam00295 Score: 241 E_value: 2e-21
Swissprot: Q00001|RHGA_ASPAC

Sequence:
>SY0AAD53YI09FM1
TTGGCTCGAAAACTACCACATCACCATCCGCGGCGGGAACAAGGGCGGCC
TAGACGGCATCGATCTAATCTGTCTGTCAAATTGCTACCTTCACCACATA
GAAGTTACCAACCGCGACGAATGTATCTCCGTCAAGACTCCCTCCAAAAA
CGTGCTCATCGAGGAGATTTACTGCAATCAGAGTGGAGGCATGAGTATCG
GGTCTTTGGACGCAGCAACCGGAAGTCAGATCGAAAGCATCCACATGAGG
AACATATACGTCCACCAGTGCACGCAGATGCTCATGATAAAGACCTGGCC
AGGCGGCAACGGTGCAAACGGGTACGTCCGCAACTCCATATTCGAGAATT
TCCACGCCTACGATACCACCTACGCCCTCGATATAGACCAGTACTGGTAC
GGGCGCACAGAGCCCAACACGGGCGCTATCGCCATCTCGGACCTTCAATT
CAAGAACTGGACAGGAACAGTCGACAACGGCATTTCTCGCGGCCCCATCG
TTATCCGCGGGAGCAATATCGTCCCCTTAACGGACATAATGATGGAAGAC
TTTCGCATGTGGACGGT

Sequences in the Contig:

SY0AAD53YI09FM1