Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD53YD21FM1
Length(NT) : 665
Best Gene Model Blast : Link to GSTUMT00005636001 E-value : 7e-34
Numbers of ESTs : 1

Blast Results:

Nr Definition: 6-phosphogluconate dehydrogenase, decarboxylating
Accession: ref|XP_001257925.1| Score: 573 E_value: 2e-57
KEGG Definition: 6-phosphogluconate dehydrogenase Gnd1, putative [EC:1.1.1.44]; K00033 6-phosphogluconate dehydrogenase
Accession: afm:AFUA_6G08050 Score: 568 E_value: 4e-57
KOG Definition:
Classification: [Carbohydrate transport and metabolism].
Kog Number: KOG2653 Score: 553 E_value: 1e-57
PFAM Definition: NAD_binding_2, NAD binding domain of 6-phosphogluconate dehydrogenase. The NAD binding domain of 6-phosphogluconate dehydrogenase adopts a Rossman fold..
Pfam Number: pfam03446 Score: 375 E_value: 5e-37
Swissprot: O13287|6PGD_CANAL

Sequence:
>SY0AAD53YD21FM1
TTGGAAACCTCACTTATCCGCCCAGTTCCGCATCTCTTAGGGCCATAAAA
TAAACCCCACCACCACCATCGTCGTCAGCCCCCTCCCCCCTCTCTCAATC
ACTTTTAATCTTTCCTCCCTCTTCCCACCCCTCTCTTCCGCTCTACATAC
TCCCTCATCTCCTCTCATCTCGTTCATTCAATCCCATTGAAGCACATAAG
AAGGTGTCATGTCTGAGACTAAAGCAATTGAGCGACTGTCCGCTATTGCT
GGCGGCTTCGCATCTTCGACACCCAGCGCTGATTTCGGCCTTATTGGTCT
TGCTGTTATGGGTCAGAACTTGATCCTCAACATTGCAGACCATGGCTTTA
CTGTTGCTGCTTTCAATAGAACCGTATCGAAGGTCGACCACTTCTTGGAG
AATGAGGCCAAGGGAAAATCCATCGTTGGTGCTCACTCCATTCAGGACTT
GTGCGACAAGTTGAAGAGTCCTCGTAGAATAATGTTGCTGGTTAAGGCTG
GCCCTGCTGTCGACGACTTCATTGCTGCTCTCTTGCCCTTCCTTTCAGCC
GGCGATATTATCATTGATGGTGGTAACTCTCACTTCCCCGACAGCAACCG
CCGCGCCAAGTATCTCGCCGAGAAGCAGATCCGTTTCGTCGGTGCTGGTG
TGTCCGGTGGTGAAG

Sequences in the Contig:

SY0AAD53YD21FM1