Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD53YB15FM1
Length(NT) : 658
Best Gene Model Blast : Link to GSTUMT00001254001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Cell cycle control, cell division, chromosome partitioning].
Kog Number: KOG0834 Score: 214 E_value: 3e-18
PFAM Definition: No Hit Found

Sequence:
>SY0AAD53YB15FM1
TTGGAATGCCTTCACCGCGTCGATCCAGCCATGAATACTCTACCACCACC
AGTGCCACCACAAAACAAACACAGCCTTTACTAATGCTTTTACCTACCGA
CTGGGCGTCTTTCCTGACCGTCATGGCCGATACTCTCCGCCTCGCGCCAG
AATCTCTCTCAATGGCATACGTCTACCTTCACCGCTATAATCGCTGGGCA
TCGGAAGAATCTTGTTCGCCGCTGGACGATCACACACTGTGCCTCGCCTC
CCTCTCCCTCTCCACAAAAGCCACTGAATCGCCCAGAAGACTTCGTGAGC
TTCTTGTACCAGCATATGCTCATCTCCACCCATCTTCGCCGCCGCTGACT
TTTCCCTCGCCCTTGTACGACTCGCTCAGGTCAACGGTTGTGGCTGCGGA
GTTGCTGCTGCTTCGCGTACTGCGATTCGACTTGCGTGTTCCGTTGCCCT
ATGACTTTCTACCGAGGTTTCTTGAGAAGGTTTTACCTCCGGTAGCGACC
CCCGGAGAGGAGGAGTGCGCGGAGACCAAGATTGTGGATATCTGTGAGAC
GGCACTCGGGAGGGAGGTTTGGAGTGTTGTTGGAAGGGTTATGACAAGCT
ATAAGATTTGTAACTTCTTTCCCGCTCGGAGTGTTGCGGCGGCTTGTTTG
TTTCATGT

Sequences in the Contig:

SY0AAD53YB15FM1