Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD53YB06FM1
Length(NT) : 680
Best Gene Model Blast : Link to GSTUMT00000580001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_07092
Accession: ref|XP_001797445.1| Score: 742 E_value: 5e-77
KEGG Definition: hypothetical protein
Accession: ncr:NCU02762.1 Score: 708 E_value: 2e-73
KOG Definition:
Classification: [Inorganic ion transport and metabolism, Signal transduction mechanisms].
Kog Number: KOG2301 Score: 200 E_value: 9e-17
PFAM Definition: Ion_trans, Ion transport protein. This family contains Sodium, Potassium, Calcium ion channels. This family is 6 transmembrane helices in which the last two helices flank a loop which determines ion selectivity. In some sub-families (e.g. Na channels) the domain is repeated four times, whereas in others (e.g. K channels) the protein forms as a tetramer in the membrane. A bacterial structure of the protein is known for the last two helices but is not the Pfam family due to it lacking the first four helices.
Pfam Number: pfam00520 Score: 138 E_value: 2e-09
Swissprot: O14234|CCH1_SCHPO
Gene Ontology:
GO:0005783 = Cellular component: endoplasmic reticulum

Sequence:
>SY0AAD53YB06FM1
TTGGGTGAAAAGGAGCCTAATCCATTTTACTCATTCGCTTTATCACGATC
TATTGCGGATCTGACCCCAACAGCCATGGCACAACAAGTGGTGACGGAGC
AGGAACGGCGAAGAAAAGCGCAGCGGGAGTATTTGAGGAAATATCCAAAC
TACAATGTCCCGTTACATATCTTTAGGTCATCTAATCCGATAAGACGTCT
TTGCCAGAGGATGGTCGGGCCTAGTCGTGCTAGTATTCGTTATGATGGCT
TACAGCCTTACACGCCTTTCAGTTATGCATTCTCAATCTTGGTCTACTGC
GCTATCGTTTCTATGGTGATCATAGCCTGCATAACAACACCTCTATATCA
GAAAGAGTACTTCGAAAAGCATGGTAGTTCTTTAAGGAATTGGTTCACGT
TCGCCGATGCTGGATTTGTTGCTCTTTTCACAATTGAGTCTCTCATAAAA
ATTGTTGCCGACGGGTTAATATGGACACCAAACGCATACCTTCGGGGATC
CTGGGGGGTGATAGATTGTGTTGTGTTGATTACCCTCTGGATTAGTGTCA
TCACCTCCTTTAGGAATCAAGGCGAGATCTCTCGAGCTGTTGGAGCATTC
AAGGCACTTCGTGCCCTACGATTACTGAACATCAGCGGCGCTGCCCAGAA
CACCTTTCATTCTGTTGTTATTCTTGGTGG

Sequences in the Contig:

SY0AAD53YB06FM1