Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD53YA04FM1
Length(NT) : 577
Best Gene Model Blast : Link to GSTUMT00009668001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: Patatin-like serine hydrolase, putative
Accession: ref|XP_001265168.1| Score: 204 E_value: 9e-15
KEGG Definition: Patatin-like serine hydrolase, putative
Accession: afm:AFUA_1G04970 Score: 203 E_value: 6e-15
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: A1D4C8|PLPL_NEOFI

Sequence:
>SY0AAD53YA04FM1
TTGGGAGGTTCCGATTCACCGCAGCCTTGACGATAGCACGAGTGAGTGAG
TTGAGTGAGTGGGCGAGTGAGTTGCTACGGCAACGTTGATCAGGATGGCG
GGCTGGGACAGGTCCAACGAGCCGAGGCGGCGGAAGCAGGAGAGGGGAGG
AGAAGAGGGGCTACCAAACTTTGATACAGACTTTGTTAACGAAGCCGGTA
GGCTCGTCCCCCCCCACCTCTATCCCCCTTAAGCCTAACGCTCTCCTCTA
GACATCGCCGCCTTCGAAAGAGCCATCAATGCACCCGATGCCACAGACGA
GGACTTTATCACCGCCTTGAACGACTGGAAGCCAATCAAGCAGCGGATCC
GACGAAAGCGGCCGAAAATGCGACCCAGGAGAGGAAAGGACGAGACGAGG
GAAGGCTTCGTCTACCAGTTGCTCAAATGGCCGTTATTGACGATTGTGTT
TGCCTGGATCCTTATTCTTTCAATCCTCTACACGATGACCCGCTTCTACG
TCTCCCAATACGAGTACTGGGTAACCTGGCGCGGGCGACGAGAACGCCTT
CGCCGAAAGCTCCGCTCGACAAAGACT

Sequences in the Contig:

SY0AAD53YA04FM1