Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD52YP17FM1
Length(NT) : 497
Best Gene Model Blast : Link to GSTUMT00002381001 E-value : 1e-150
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein YfreA_01004244
Accession: ref|ZP_00827560.1| Score: 168 E_value: 9e-11
KEGG Definition: ribonuclease Z [EC:3.1.26.11]; K00784 ribonuclease Z
Accession: ter:Tery_0641 Score: 157 E_value: 9e-10
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG2121 Score: 160 E_value: 3e-12
PFAM Definition: Lactamase_B, Metallo-beta-lactamase superfamily..
Pfam Number: pfam00753 Score: 109 E_value: 2e-06
Swissprot: Q118J2|RNZ_TRIEI
Gene Ontology:
GO:0042781 = Molecular function: 3'-tRNA processing endoribonuclease activity
GO:0008270 = Molecular function: zinc ion binding

Sequence:
>SY0AAD52YP17FM1
TTGGGTTGCAATAAACTGGTGGCTGCGACTGTTTAATAAAAACACAGCAC
TCTGCAAACACGAAAGTGGACGTATAGGGTGTGACGCCTGCCCGGTGCTG
GAAGATTAAATGATGGGGTGCAAGCTCTTGATTGAAGCCCCATTCAGGAT
CGTTGCCAGCAGCGGGACCAGGCCGAAAACGTGGTCGCCGTGGAGGTGCG
TTATGAATATTTTTGAAATTTTGGAGTGTTTGATAGAGTAGGAGGGTTTT
AGGCGCTGGATTTGACCCTGGGTTCCCTCACCGCAGTCGAATAGGAGGGT
TGTGCTGGTTGGTAGGACGATGGCTAGGGAGGAATGACCCCGTGTTGGGG
TTGAGATGGCGGACGAGGTTCCAAGTGGGAGGAGGATTATCGGGGGTGGC
ATTTTGAGGGAGGTGTTGGTTGTTTTCGAGTGTTTTGTCGATGGGAGGGG
ATAACTTTTATGTCGGAGGAGCGAGCAAATGATGTTTTACCCCCTGA

Sequences in the Contig:

SY0AAD52YP17FM1