Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD52YP05FM1
Length(NT) : 648
Best Gene Model Blast : Link to GSTUMT00004275001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_747684.2| Score: 627 E_value: 1e-80
KEGG Definition: conserved hypothetical protein
Accession: afm:AFUA_6G03930 Score: 627 E_value: 6e-81
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAD52YP05FM1
TTGGCAAGTGCATTTCACTTCAAGCGGCCTAGTCTTCATCGCCCTGTCAT
CGGATTCACTACCATTCGAAGAATTCTTTCCAGATCTCGAACCTCTTTTA
TCAAAAGTAAATTTCACCAAATTAAAGTATCGCCGGAGCATTTCCTATGA
AGGTGGTTTCAACTGGAAAACCATACGGCTACCAAGAGTGTCTCCATTGC
CAGTACGCCCATCCTTCCTTTAGCAAACGCTATCCGCCTACTTTCTACTC
GATTCAGAACCATGGTAACTTTTGCAGACACATTGCCGACCCCAAGAAGC
CTGACGATGGACTCTTCTTGTACTTCTTCCCAATCTGCACACTAAACGTC
TACGGCGGTGGCATGTCCTCATTCCGCACATGCCCAACTTCGGACCCCAC
CATCTCAAGAATGGAGTTCGACTACTACTACAATGGAGAAGACGAAGCCT
TTGAGGAGTATTTCAAGTTTGTGCGACAAGTTGCCCTAGAAGATTACGAG
TTGTGCGTTGCTGCTCAACGAAATCTCCAGAGAGGTGTGTATGTAGAAGG
GGTGCTGAACCCTGAGAAGGAGAGCGGGGTGATATATTACCAACAGCTAG
TCAGAAATCTAGTCCTAGAAAAATACAAAGCCGAGAAAGCGGAAGCAG

Sequences in the Contig:

SY0AAD52YP05FM1