Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD52YO23FM1
Length(NT) : 642
Best Gene Model Blast : Link to GSTUMT00010508001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein NCU02287
Accession: ref|XP_959931.1| Score: 657 E_value: 3e-67
KEGG Definition: hypothetical protein
Accession: ncr:NCU02287.1 Score: 657 E_value: 2e-67
KOG Definition:
Classification: [Energy production and conversion].
Kog Number: KOG0537 Score: 167 E_value: 7e-13
PFAM Definition: Cyt-b5, Cytochrome b5-like Heme/Steroid binding domain. This family includes heme binding domains from a diverse range of proteins. This family also includes proteins that bind to steroids. The family includes progesterone receptors. Many members of this subfamily are membrane anchored by an N-terminal transmembrane alpha helix. This family also includes a domain in some chitin synthases. There is no known ligand for this domain in the chitin synthases..
Pfam Number: pfam00173 Score: 147 E_value: 1e-10
Swissprot: Q8X0J4|CYB5L_NEUCR

Sequence:
>SY0AAD52YO23FM1
TTGGAGCTACTGAGGTGGCCGAGCATAAGAAGCCCGACTCGCTGTGGATC
ATCGTTGAGGACGACGTATACGACGTTACAAAGTTCCAAAATGACCACCC
GGGCGGAAAGAAGATCCTGCAGAGGGTTGGCGGCAAGGCCGTGTCGCTAC
CAGAACCGAAGAAGGTGGAACCAAAGGAGGAGCAGGTTATTATGCGAGCC
GGACCCGTTGCCCCAAGCCCAACGAGCGAGGTACACGAAGTGAAGGAGGC
TCTGGACACTTATGGTGACCTCATTCCTTTTGGCGACCCTGCTTGGTACC
AGGGTTATCATTCACCTTACTACAATGCGTCGCATGCTGCCCTCAGGGAC
GAGGTTAGGGCGTGGGTTGAGGAGAAGATTGAGCCCCACTTGAATGATTG
GGAGAAGCAGAAGTTCGTTCCTGTCGAGATTTACAAGGAGATGGGTACTC
GCGGTTATCTTCCGGGTCTGCTTGGCGTCAAATACCCCAAGGAATATACC
CCGTATAGCGTTGCTTCTGTTCCCCCGGAGAAGTGGGATCACTTCCACGA
GTTTATTCTTACCGATGAGCTATCGCGTACCGGTTCCGGTGGATTTGTAT
GGAACATGATTGGCGGTTACTCGATTGGTCTTCCTCTGGTAT

Sequences in the Contig:

SY0AAD52YO23FM1