Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD52YN08FM1
Length(NT) : 641
Best Gene Model Blast : Link to GSTUMT00006357001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_13417
Accession: ref|XP_001548040.1| Score: 847 E_value: 3e-89
KEGG Definition: hypothetical protein
Accession: ncr:NCU00395.1 Score: 819 E_value: 3e-86
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: P32335|MSS51_YEAST
Gene Ontology:
GO:0019898 = Cellular component: extrinsic to membrane
GO:0005743 = Cellular component: mitochondrial inner membrane
GO:0005759 = Cellular component: mitochondrial matrix
GO:0005515 = Molecular function: protein binding
GO:0045727 = Biological process: positive regulation of translation

Sequence:
>SY0AAD52YN08FM1
TTGGCCAGGGGAACAGATGGACGAGGCTTTGATCAATTTTACGAATTGGG
ATACTCTGTTGTACACCAGGGACTATAAAGCTATTAACGACGAAAGATCC
CTGAGGCAGGTTACGAAGTTGTTGACATATCCGATCACTGTCGCGAGCTT
TATGCATGAGTTGAGCCCTTACGATATGAGGCACAGATTGACTATGGAGG
GACTGAAGAGTGTTAGCGCACTACGTTACACTCTACATCCACCCCGCGTA
GGTGCTGGAAAGGACATTAAAGGAATTCGGGTTACTCCACCTCCGGTCCG
CCTGTTCATTCTTGGTGCTCGCTCAGAGTCTTCTCTTCCCCGAGAAGTTT
GGCATCAACTCACTCACATGTTCCCGCTCTCCACTTTCCACCTTGTCTTC
ATCGGGCCACAATCTATGATGAACCGGGACGCCGAACTCCCACTTCCTGA
CCGAACCCCGGCAAACCCGTTTGGTGCAGTGGTGGAACGAGTGTCCCACA
ACATGAAGGTCTCGACCTTCGTAGAGTATTACCATACTCTCCATGACACT
GGCATATTCAACCCGTATGATCCGTACTTTGACATGTTTGTTTTATTCCA
TCCAGGTTTGGGTCATCCGGGGAGTGCAGCAGAGTGGGAGA

Sequences in the Contig:

SY0AAD52YN08FM1