Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD52YL20FM1
Length(NT) : 618
Best Gene Model Blast : Link to GSTUMT00007507001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CIMG_03790
Accession: ref|XP_001244349.1| Score: 189 E_value: 1e-20
KEGG Definition: hypothetical protein
Accession: ang:An02g06810 Score: 162 E_value: 4e-15
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG3943 Score: 156 E_value: 1e-11
PFAM Definition: No Hit Found
Swissprot: P87151|YB0A_SCHPO

Sequence:
>SY0AAD52YL20FM1
TTGGAACTCCCACTTCAACCATCAACTCCCGAGTCGACGTCAGCTTAAAT
GGCAGGCAATAAGAAACGCCGCAGCGACAATGAGGGCTTGGATCCTAAAT
CGGTCAAGAAGAGCAAGGCCAAAGAGTATTGGAAGAGCCAGGCAAAAGCC
AAGTACCACAGCCTCCACAGCATTGAGGAAGGCTCGCAGGGTATATTCGC
TACCTGTGACAGAGGCCGAGAAGCGAGATGCGTCGAAGAGATGTGGCCTC
CGAGCTTTACGGTCTCGACCTGTCCGATGACAAGAACGGCGGGGGCGAGG
ACGATGAGGACGAGGATGAAGATATCGAGGCATCGATCCAGAAGGAGATT
AGTGATCTGAAAGGAGCCAAACCCGAGAAACCATTTATCTCGGTGAAGCT
TGATGTGGAGTGTGTTATCTTCTTCCGCCTAAAACCTCCTTGCGAACCAA
TTGCCATGGTCAATGCACTCTGTGCCGGAACTGTGGAGAACCGTCTCAAG
AGCCGACACGTCCATCGCCTTACTCCTGTTACTCGGATTGGCAAGGCGAA
CGCTGAGGGCCTGGAAGCCGTCGCCAAGGAAGTCCTTCCTCCCCACTTTC
ACCGAAGTGAGGAATGCA

Sequences in the Contig:

SY0AAD52YL20FM1