Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD52YL08FM1
Length(NT) : 664
Best Gene Model Blast : Link to GSTUMT00007868001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: cohesin complex subunit (Psm1), putative
Accession: ref|XP_001263613.1| Score: 555 E_value: 2e-55
KEGG Definition: cohesin complex subunit (Psm1), putative; K06636 structural maintenance of chromosome 1
Accession: afm:AFUA_3G08260 Score: 547 E_value: 1e-54
KOG Definition:
Classification: [Cell cycle control, cell division, chromosome partitioning].
Kog Number: KOG0018 Score: 222 E_value: 3e-19
PFAM Definition: Myosin_tail_1, Myosin tail. The myosin molecule is a multi-subunit complex made up of two heavy chains and four light chains it is a fundamental contractile protein found in all eukaryote cell types. This family consists of the coiled-coil myosin heavy chain tail region. The coiled-coil is composed of the tail from two molecules of myosin. These can then assemble into the macromolecular thick filament. The coiled-coil region provides the structural backbone the thick filament..
Pfam Number: pfam01576 Score: 112 E_value: 2e-06
Swissprot: O94383|SMC1_SCHPO
Gene Ontology:
GO:0030892 = Cellular component: mitotic cohesin complex
GO:0005634 = Cellular component: nucleus
GO:0046982 = Molecular function: protein heterodimerization activity
GO:0007064 = Biological process: mitotic sister chromatid cohesion

Sequence:
>SY0AAD52YL08FM1
TAGGCAATCTTGAGAAGAATGCCGAAAGAGACAGAATCACGGTGGAAGAA
CTTGAAGCCGAAAAGGCGCAGATCCAGGAACAAATGGATGTTGTGATGGC
CGAGGTTGAACTCTTGCGTGAGGAGTTGGGGTCGAGAAGAACTGAGCTCG
AGACCCGGAGCGAGAAGGTCAATGGACTGCGGAGGGAAGTCTCCAAGCGA
AGTAAAGACGTCGAGGACACTACAAAGCTGATTTCTGGTTTGGAAGGGGA
AATCGAAAGAGATTCTGCGGGTCGATACGCTGTCCTTAGAAGGTGTAAAC
TGGAGGAGATTGAAATACCACTGACTGAGGATTCTGCACCACTGGATGAT
TTGCCCATCGATGATACTCTGCAAACCGACCCCGATGCAATGGACGTGGA
CGAGGACGAGGATCCTAGCTCTAGTGCTGTCCAGAAGGTTCAGATACAGG
ATTATGGCATCGAGGTGGACTTTGAAGATCTCGACGACGATCTCAAAGAG
AGTGGTGACGAGAGAGTGGAAGAGGAACTCCTGGACAAGATCAAAACCCT
CAGTGCCGAGCTCGACCGCATGGCGCCCAATATGAAGGCCATCGAGCGCC
TGGAGGGCGTTGAATCCCGCCTGCACGAGACTGACAAAGACTTTGACAAT
TCCCGTCGCGAGGC

Sequences in the Contig:

SY0AAD52YL08FM1