Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD52YK13FM1
Length(NT) : 380
Best Gene Model Blast : Link to GSTUMT00011251001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: ubiquitin-conjugating enzyme, putative
Accession: ref|XP_001263160.1| Score: 253 E_value: 1e-20
KEGG Definition: ubiquitin conjugating enzyme, putative [EC:6.3.2.19]; K10581 ubiquitin-conjugating enzyme E2 O
Accession: afm:AFUA_3G13060 Score: 240 E_value: 2e-19
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0895 Score: 250 E_value: 6e-23
PFAM Definition: UQ_con, Ubiquitin-conjugating enzyme. Proteins destined for proteasome-mediated degradation may be ubiquitinated. Ubiquitination follows conjugation of ubiquitin to a conserved cysteine residue of UBC homologues. TSG101 is one of several UBC homologues that lacks this active site cysteine..
Pfam Number: pfam00179 Score: 143 E_value: 2e-10
Swissprot: Q6ZPJ3|UBE2O_MOUSE

Sequence:
>SY0AAD52YK13FM1
TTGGGCTCCGTGTCCGCCGAGCAGTATGCCAGCTCCAGAAGCATTCTCGA
TACCAGAAACTTCCGAGAAGCCTGCCCAGTTTGCCATTTTAGATACTCCG
GTTCCCTCCGATCACAGGTTCATAAAGGGTTATGCAACACGCATAGAGCC
GACGTTTCTCCGCCGCATGCATAAAGAACATAATATTCTCTCGACGTCCC
TCCCGGATGGGATCGTGGTCAGGGGGTGGGAGTCGCGTCTTGACCTTTTG
CGTGTGCTTATAATCGGTCCTATGAACACCCCGTACGAGCTGGCGCCATT
CTTCTTCGATTTCTATTTTCCTGGCGCTTTTCCTCAATCTCCGCCTATTG
TGCATTTTCATAGTTGGACCGGAGGTGTTG

Sequences in the Contig:

SY0AAD52YK13FM1