Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD52YE03FM1
Length(NT) : 635
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein An10g00890
Accession: ref|XP_001402480.1| Score: 135 E_value: 1e-06
KEGG Definition: hypothetical protein
Accession: ang:An10g00890 Score: 135 E_value: 6e-07
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAD52YE03FM1
TTGGCCTGTGTCTCAAAAAAGGCGGAGGTGGTGCAGCATTGCGATGTCTT
GCCGGCACAGGAGATAATGGCCACACATCCACTAAAATCCTCTTGAAGGC
ATGGATTCCGCGGTTGCGCTTTGATGATGTCGATAATCTGTGCTAGCCCC
GCGATCAGAGCGGCGCATCCTTGTTCACGATCGTTGACAATAGCTGCATT
GGCACTTTGGAGGCGGGAGATCTCCACATCAACCAGAATGGCTGCGCCGG
GAGTGATAGACTTCACATATGGGTTGCTTTGATTAGGTATGAAGGAGGGA
AAACACTACGAGTGCTTGGAGGTAATAGCAACCGCCAAACACCACGCCGT
TAGTGCGAAGGGAATAACGCTACTCCACGGGTTAGGCTTCAACACCGGCA
AACCAAGTAATGACGGCCCATGACGACTCGCACTTGCAGCCAGTAATGGT
TTGGACCGGGCGACATCAACACCCGGTAAATTGGATAAGTGCAAGGGAAC
ACACTATGGTGGGCTGCGGCAAACGAGCATGAAGGAGCGGTGAAAATGCT
ACTTGAACGGGGCGACGTCAACCCCGACAAAAGCGATAATAGAGGGGGAA
CACCCCTCAGTATGGCGGCAGAAAATAGAAGTGCG

Sequences in the Contig:

SY0AAD52YE03FM1