Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD52YD09FM1
Length(NT) : 567
Best Gene Model Blast : Link to GSTUMT00010749001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CC1G_11655
Accession: gb|EAU83129.1| Score: 283 E_value: 6e-24
KEGG Definition: hypothetical protein
Accession: cne:CNB02760 Score: 228 E_value: 7e-18
KOG Definition:
Classification: [Cell cycle control, cell division, chromosome partitioning].
Kog Number: KOG2687 Score: 258 E_value: 1e-23
PFAM Definition: Sad1_UNC, Sad1 / UNC-like C-terminal. The C. elegans UNC-84 protein is a nuclear envelope protein that is involved in nuclear anchoring and migration during development. The S. pombe Sad1 protein localises at the spindle pole body. UNC-84 and and Sad1 share a common C-terminal region, that is often termed the SUN (Sad1 and UNC) domain. In mammals, the SUN domain is present in two proteins, Sun1 and Sun2. The SUN domain of Sun2 has been demonstrated to be in the periplasm..
Pfam Number: pfam07738 Score: 254 E_value: 4e-23
Swissprot: Q09825|SAD1_SCHPO
Gene Ontology:
GO:0031965 = Cellular component: nuclear membrane
GO:0005816 = Cellular component: spindle pole body
GO:0005515 = Molecular function: protein binding
GO:0051225 = Biological process: spindle assembly

Sequence:
>SY0AAD52YD09FM1
TTGGGGCAGGGGCTACCACCACTTCGTCTGGCGCCTCTTTGGCCGGGGTG
CGCGGATTTCGCCGCCACCAGCACTGGCCATAACCCCGTCCACAGAAGTG
GGTGAGTGCTGGCCCTTCCCCGAGCGCTCGGGGGACATTGGCATTAAGCT
TGCCAAGCCGATCTACGTCTCGCACGTCACAATCGACCACGTGCCCAAGC
AGCAAGCCATCGAGATCTCGTCCGCGCCGAAGAATATCGAATTCTGGATC
CGCGTGCCCGCGGAGCGCAAGGAGGAGCTGCAGAAGGCGGTAGGCAAGCC
CGCCAGCGAGTGGTTCCGCCAGGACAGCGACACGCAAAAAATACAACAGC
AGCAGCTGCAGATGTCGGGTAACAACGGCGGAGAGTGGGTGCGTGTGCAC
GAATTTATGTACGACATTCACACCGCTGGATCACCGGTCCAGACATTTGA
ACTGCCCGTCGACCTCACCAGGCTCAACGTCACCAGCCACTTCGTTGCAT
TTAGGATCGTGGATAATTGGGGGCATCCTAATTTCACGTGTTTGTATCGT
GTTCGGGTGCATGGGTA

Sequences in the Contig:

SY0AAD52YD09FM1