Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD52YC21FM1
Length(NT) : 626
Best Gene Model Blast : Link to GSTUMT00003872001 E-value : 1e-161
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein MGG_02512
Accession: ref|XP_365810.2| Score: 209 E_value: 3e-15
KEGG Definition: hypothetical protein
Accession: mgr:MGG_02512 Score: 209 E_value: 1e-15
KOG Definition: No Hit Found
PFAM Definition: DUF1783, Fungal protein of unknown function (DUF1783). This is a fungal family of uncharacterised proteins..
Pfam Number: pfam08695 Score: 285 E_value: 1e-26
Swissprot: P40452|YIP7_YEAST
Gene Ontology:
GO:0031305 = Cellular component: integral to mitochondrial inner membrane
GO:0045727 = Biological process: positive regulation of translation
GO:0008535 = Biological process: respiratory chain complex IV assembly

Sequence:
>SY0AAD52YC21FM1
TTGGCGGGGACAACTTTGTACAAAAAAGTTGGCCACACCTTGCTTAAACG
TTACCTCATTCCTCTCCACACTCCACCGCGTCCCACCTTTCAGTTCTCAA
ATCGCAGCCCCACTAACCTCACAGAATAAAATGTTCAAATCCCTACTGAG
AACCCATCTTCCCTTCTCCTTCCTCTGCCGCTCCCGGTCATTCCCTCCTC
CCCTCCCACGCACACTAACGACGACTGCCCGACCAATAGGCACATTCACC
GACCGTCGTCCCGACCGCCCACTCCCCGGTTCTTACCCCCTCCCCCCTCC
TCCCCACCAACCGTCCACTAACGCCCCTTCCAATTCTCAGACACCACCAA
AACCCCCACTCTAGCACTCCTCACAATCCCGCTCTTTACTAGCCTACTCC
TACTCGCTACTATCGGCATTTTCAATTACCAAAAGTCTTCCTCGAGCGTG
GTTTCGTCGACTCTGTACGCGCTGCGCGTGCACCCCGTCGCTCGCGAATC
TCTGGGGGAGGACATCTCGTTCAAGAGTAGGATGCCATGGATTCAGGGCA
CGATGAGTCAGTTACGCGGGGATATTGACATTGCTTATAGCGTCAAGGGG
ACGAGGGGTGAGGGGGTCATGCGCTT

Sequences in the Contig:

SY0AAD52YC21FM1