Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD52YB14FM1
Length(NT) : 658
Best Gene Model Blast : Link to GSTUMT00008809001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: HAPC
Accession: dbj|BAA28356.1| Score: 439 E_value: 7e-42
KEGG Definition: CCAAT-binding factor, subunit A (HAP3)
Accession: aor:AO090003000963 Score: 439 E_value: 3e-42
KOG Definition:
Classification: [Transcription].
Kog Number: KOG0869 Score: 389 E_value: 1e-38
PFAM Definition: CBFD_NFYB_HMF, Histone-like transcription factor (CBF/NF-Y) and archaeal histone. This family includes archaebacterial histones and histone like transcription factors from eukaryotes..
Pfam Number: pfam00808 Score: 245 E_value: 6e-22
Swissprot: P63140|NFYB_RAT

Sequence:
>SY0AAD52YB14FM1
TTGGCCGGGCCTCAGGTGCACCACCACCATCTACTCGAGTATCCGTATCT
TAACAGCAAGCGGCTTGCTCAGCAGGTCTGCCGTCAGAAGGAGGTGTGCG
TCAACCAACTACGTCTTTCGGTCCACCACCACCATCACCGCTACACATTA
CCTACTGTCTGCTGCCACCGCCTACTGTGCTGCAATACTGGGATTCGGTC
CGGGAAGAGGACGCATAGGCTTGCAACCACCGACACGTCATCACGATTGG
TTGTTCACTGACGGCCGACCAGCACATCCCATAGCTGGCATCTCAGATTC
TCACCCAGCGTACACCATATCATGTCGTTTCCCCCTCGAAAGACCTGGAG
GGTGAAGTTGGAGTGCAGTCGCCTGACGAACAGGAGCACATGGATCAGCC
GGAAACTTCTCAACAGCAGCCTGCGTTTGATTTTGAGGTCAAAGAACAGG
ACAGATGGCTACCAATTGCGAACGTCGCTCGAATCATGAAAACCGCGTTG
CCGGAAAACGCCAAAATCGCAAAGGAGGCAAAAGAATGTATGCAAGAATG
CGTCAGCGAGTTTATTTCATTTATCACCAGCGAAGCATCGGAAAAATGCC
AACAGGAGAAAAGGAAGACGGTCAACGGAGAAGATATACTCTTCGCCATG
ACATCACT

Sequences in the Contig:

SY0AAD52YB14FM1