Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD51YP10FM1
Length(NT) : 528
Best Gene Model Blast : Link to GSTUMT00004090001 E-value : 1e-163
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein An15g06030
Accession: ref|XP_001397132.1| Score: 330 E_value: 2e-29
KEGG Definition: hypothetical protein
Accession: ang:An15g06030 Score: 330 E_value: 9e-30
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG2903 Score: 283 E_value: 1e-26
PFAM Definition: No Hit Found
Swissprot: P36156|GTO2_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0004364 = Molecular function: glutathione transferase activity
GO:0007047 = Biological process: cell wall organization and biogenesis
GO:0009636 = Biological process: response to toxin

Sequence:
>SY0AAD51YP10FM1
TGAATTACAGAGCAATGGTGAAACTTCACCCTTTAGGACAAAAATGGGGA
CCGCTAATCAGCTTTGATAGTCTACCTCTGGTCAGAAAATCACCGATTGG
GTATCTACAGTGTGGTTTCCCTCCACAGGTTGGTTGATCACTACTAACTG
ACAACAAGGACTCTAAACGTGGGGAATTCAATCGCAAGCCCGTAAGTTCC
TCCGTTCGAGCAAAAACCAATTCTGACAATCTCCTCCAGTCAACTTTCTG
CGACCTGGTTTCTCGTGAGCCCAATGCCAAATTCCCTCCTGAGAGAGGTC
GCTACCACCTCTATGTTAGCTATGCCTGCCCATGGGCACACCGAACCCTC
ATCACCCGCGAGCTCAAGGGCCTACAAGACATAATTGGTGTTAGCGTAGT
GCACTGGCACTTGGGAGAGAATGGCTGGCGTTTCGGTACCACCGAGGAGG
CCGGCGAGTATCCAGAGGTGGCTGTTGGTCCGGAAGCAAACACTGGGGCG
TCATTCCTGAGGGATATCTACTTCAAGG

Sequences in the Contig:

SY0AAD51YP10FM1