Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD51YL24FM1
Length(NT) : 447
Best Gene Model Blast : Link to GSTUMT00002721001 E-value : 1e-112
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein FG04277.1
Accession: ref|XP_384453.1| Score: 123 E_value: 5e-10
KEGG Definition: hypothetical protein
Accession: fgr:FG04277.1 Score: 123 E_value: 2e-10
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAD51YL24FM1
TTGGCTACGCTCCCCATCTTCTGATCTACGAAATACCGTCATGACGGATC
GCCGACGCATCAATGGCCCGCTGGAGGGCACTATACCGCCGGTATTCCTC
ACTAGCTCGACTCATAAATCAATAATTAAACGTTCACCAACTACTCTTCG
AAAAATCTGTTGGTATCCTTCCTTTCTTTTTCCACCCCCTTCCCTCATTC
TCCTCCTCTGAATACAAAACCTAATCAATCTCTTGCTCCGGTAGTTCTGA
AAACCGGCCTAACTCCACCCGCAACGGGCTCTGCATTCTTGGAACTCCCG
ACACCCTCCACCCATTCAACACCCACTCTAAAGCTCACCTCGAGTGTCTA
CGGTCCCCGGCCCTTGCCTTCATCAACAACCTTCTCCTCAAACGCGCGCC
TGACCGCCGAACTCAAGTTTTCGCCGTTTTCCACTCCCGGCCGCCGT

Sequences in the Contig:

SY0AAD51YL24FM1