Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD51YL23FM1
Length(NT) : 580
Best Gene Model Blast : Link to GSTUMT00000030001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein NCU09226
Accession: ref|XP_959170.1| Score: 138 E_value: 4e-07
KEGG Definition: hypothetical protein
Accession: ncr:NCU09226.1 Score: 138 E_value: 2e-07
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAD51YL23FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCCAACTTTTTTGTACAAAG
TTGTCCCCTGAAGAGGGAGTTGGTGGAGTTGAAGGATGCGTGTGGGCATG
GGACGGCATGGGAGTGTTTTGACGAGGAGAGTACCGGTATGAGTGGGAAA
GGGAAGGGACGGGAACAACCACGGGGGTCCACATCGAACAATAGCGCAAA
GAAAGACGCAGTCGACCTTACCAACGACGACTCCCAGGCACCACCTCCCA
ACTGCAAACCTCAAACCCTCAACCCACCATTGGCACTGCCAAACCCTCAA
AATCCCATCCTATCCCTTTCCTCTCGCCCTAAGGCCAAGGCCCCCAACGA
GGCTTCAAAAACCACCTGCACCGCATGCTCATTCGCTAACGACCCAACGT
CGACGCTGTGCTGCTTCTGTGCTAATGTTTTAAATCCTGGGCGTATGAAG
AATGCATGGAAGTGCTCGTGTTATGGAGATTTGCGTTATATGAATCCGGG
GGATGCTGGTATCTGTGGGGTTTGTGGAGGGAGGGGTGGTAGGGGGTGGT
AGGGGGTGGTAGGGGGTGGGTTGGAGTTTT

Sequences in the Contig:

SY0AAD51YL23FM1