Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD51YL12FM1
Length(NT) : 543
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 1

Blast Results:

Nr Definition: leucine rich protein
Accession: gb|ABH09321.1| Score: 122 E_value: 1e-10
KEGG Definition: hypothetical protein
Accession: lpn:lpg2751 Score: 142 E_value: 5e-09
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAD51YL12FM1
TTGGCTTAGAAGCAGCCACCCTTTAAAGAAAGCGTAATAGCTCACTAGTC
GAGTCGGCCTGCGCGGAAGATGTAACGGGGCTCAAACCATACACCGAAGC
TACGGGTATCACGTAAGTGATGCGGTAGAGGAGCGTTCTGTAAGCCTGTG
AAGGTGAGTTGAGAAGCTTGCTGGAGGTATCAGAAGTGCGAATGCTGACA
TGAGTAACGACAATGGGTGTGAAAAACACCCACGCCGAAAGACCAAGGTT
TCCTGCGCAACGTTAATCGACGCAGGGTTAGTCGGTCCCTAAGGCGAGGC
TGAAAAGCGTAGTCGATGGAAAACAGGTTAATATTCCTGTACTTCTGGTT
ATTGCGATGGAGGGACGGAGAAGGCTAGGCCAGCTTGGCGTTGGTTGTCC
AAGTTTAAGGTGGTAGGCTGAGATCTTAGGTAAATCCGGGATCTTAAGGC
CGAGAGCTGATGACGAGTTAACTTTTAGTTAACGAAGTGGTTGATGCCAT
GCTTCCAAGAAAAGCTTCTAAGCTTCAGGTAACCAGGAACCGT

Sequences in the Contig:

SY0AAD51YL12FM1