Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD51YJ12FM1
Length(NT) : 611
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 1

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG0107 Score: 146 E_value: 2e-10
PFAM Definition: DUF1777, Protein of unknown function (DUF1777). This is a family of eukaryotic proteins of unknown function. Some of the proteins in this family are putative nucleic acid binding proteins..
Pfam Number: pfam08648 Score: 122 E_value: 9e-08

Sequence:
>SY0AAD51YJ12FM1
TTGGCGTAGGCCCAAGTGTGGCAATTACGCTCATTGGGTGCCGGTGCTGC
AACGTATTTCCCAGACCTATTTTTTGTTTTTTTGTGGTAAATCTCTGGAT
TCCCGGATTGAGTTAATCTCTCTCAACTGTTTACATGAGGCCAGTCGTTT
CTATGAGTACAGGTACATATCTTTGATACACAGTATGGCAGCGAACAAGA
ACTGGTAAAATATGAGAACAAGATACCGTTCTTATTGATGATAATAATAC
AGTGGTAACGCTGGAAAAAATCAGCAGAAGATTAGAGGAAAAAATCGAAA
ATTGGAGGAAACCCTTCAAACCCGCCCAACCGGCACTCCCGGGTAAGGAA
GATTTTTGGTAAAGAATTATTGTTGAAAAACGAGGAGTGGGAAACGGATT
GAGATAGCGGTCTTCCTAGCGCCTTCGTGTCCCAATCCCTCTCGCTCTGC
TCCTGCTCCTGCTACGGCTCCTACTACGGCTTCTGCTCCTGACCCTACGA
GTACGGCTCCTAGACCTACTGTAGCTCCTCGAGCTGTAGCTGCTGTAGCT
CGGGCTTCTTCTTCTCCCACGTCCCTGCCCAGCTCCATAACGACCTCCAC
CGGTTCTAGGG

Sequences in the Contig:

SY0AAD51YJ12FM1