Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD51YJ02FM1
Length(NT) : 604
Best Gene Model Blast : Link to GSTUMT00000036001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein FG00191.1
Accession: ref|XP_380367.1| Score: 324 E_value: 1e-28
KEGG Definition: hypothetical protein
Accession: fgr:FG00191.1 Score: 324 E_value: 6e-29
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAD51YJ02FM1
TTGGCGGGAATGCTGAAGGCTGGGCTTGGTACTATAGTTGCAGATCAGAG
CGAAGGGGGAACCAGAGGGCCGAGTGGTAACAAAAAACCGGATGATGATA
AACTGCAAACACCAGGGACCTCTAGAGCGCGTTCATTATCGCTCAGTGAC
AAGCCGCCTCAGCTGGTATCAAATAAAACGACGGAGAAACGGAATGGGGA
ACTAGCGGGGATGCTTAATACGCTTATACAGTTCTTTGCGCACTTGCATA
CGAGTTGCCCAACCTTCCGGGAGTTTTGTGCAACTTCGTCCTTCATCCAG
GAGATGCTTGGAATCCTGTTTCCAATTGTTTGTAGCTCTGACCATGTCAG
CGCAGAAACGGAGCTAAATTCGAAGGATTCAGCACTGACATTCGATGGCG
GAGATGTAGTGATTCGACCTTTGGTTTCAAATGTTGCTCCTCCCATTGTT
CGTACTGTGACTGTTGACGAGCCTCCTAGTCCAACTACACCACGATCAGA
TAGGTTAAGGAGAGGCTCCAGCTTTATACTTGTGACATCAGAGCCGACAC
CCTATACTCCTTCTTCCGCGCGCCTCTCGCCAGCCATTGGGACAGGTTTG
AGAA

Sequences in the Contig:

SY0AAD51YJ02FM1