Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD49YP12FM1
Length(NT) : 578
Best Gene Model Blast : Link to GSTUMT00001336001 E-value : 3e-54
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein FG01960.1
Accession: ref|XP_382136.1| Score: 204 E_value: 9e-15
KEGG Definition: hypothetical protein
Accession: fgr:FG01960.1 Score: 204 E_value: 5e-15
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAD49YP12FM1
TTGGAACGAAAGCACTGCGAAAACATCTCCCAAAGAAAATCCTCAAAATG
CCTTCCTATATCATAACCGTGAAGCCAGAGACCTCCGACTCGGAACTGCT
AAAGATCAAGGACGACATCGTCGCCCAAGGTGGGAAAATCACTCACGAGT
ATTCGCTAATCAGGGGGTTCTCGTGCGAACTCCCTGTTAACCAGGTTTCC
ACCTTGGAGACTCATAGACATGTGCAGAGCCTGGAGGTTGATGGCACGGT
TACTACTCAGTAGTGGTAAGTTACAATGAATAAAGGACACACACATTTCC
TACTCCAGATGGATAGTCGTCCGCTGTGCATAATAATGTCGTGGGTGATA
CCGGTATGGGGTGGTTTTGCCACTCGGTAGGGGTTGATTGTTTCACGTCT
ATTCTGTGTTCTATTCTATTTGATTTTTCTCTCCTGTCTCTTGCTCTGCG
TTGCCCGTAGTGGGCAGGGTACGGGGGGCTTTGGAATAGGTTTGGGAGGA
AGAATGGATGGGGCTATGATGGGATGGATAATTGGTCTTGTACTGGGTCT
GAAATAGAAAGTTTCGGTGTTGAATTGA

Sequences in the Contig:

SY0AAD49YP12FM1