Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD48YB06FM1
Length(NT) : 578
Best Gene Model Blast : Link to GSTUMT00011525001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG3655 Score: 108 E_value: 4e-06
PFAM Definition: HPC2, Histone promoter control 2 (HPC2). HPC2 is required for cell-cycle regulation of histone transcription. It regulates transcription of the histone genes during the S-phase of the cell cycle by repressing transcription at other cell cycle stages. HPC2 mutants display synthetic interactions with FACT complex which allows RNA Pol II to elongate through nucleosomes..
Pfam Number: pfam08729 Score: 107 E_value: 4e-06

Sequence:
>SY0AAD48YB06FM1
TTGGAAAACGGGCTACACAATACTCTTGTTATGGCATCCCAATTTTCAGG
CACGAACGGGACCGATATTAAAACCTCCGCTGCTCCCGCCGGATCATCAA
AAACCCTACCACCATTATCCACAAAATCCCCAACCCTAACGCCTCAAGGA
CAACTCACTGGAGCAGCAATATTAAACCGACAACGAAGCACCTCACCAAA
GACCATGTCAACGGAACACAAGAACACTCCCACCACAACCACCACCACCC
CCGCCGCCAACGAACTGCCAAAACAGTCGCCGAATCCCGCAGCACTTCTA
ACTGCTGGTTTTGGGATGAGTGCTCCCACGGATGTACCTAAGGAGGAGCC
TACTCCCTCCCGGGAACTAGGCAGTCTACCCGGCGTTGCGGCAGCAGCTG
CAGCAATGGAAGAGCGCGAGTCCCCGACAGCAACCACTATGTCAGGAACA
GACAGTGCGGGTCTTACTACAGCAGCACCACCACAGGTCACTACCCCACT
TTTGCTACAAGAGCAGTACCCACCACTCCAACCTCAACCTCCTCCACAAA
CCCAGACGCAGCAACCGCGGGATCAAAA

Sequences in the Contig:

SY0AAD48YB06FM1