Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD46YH10FM1
Length(NT) : 598
Best Gene Model Blast : Link to GSTUMT00004391001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001212609.1| Score: 491 E_value: 5e-48
KEGG Definition: flavin-binding monooxygenase, putative
Accession: afm:AFUA_6G13790 Score: 487 E_value: 8e-48
KOG Definition:
Classification: [Secondary metabolites biosynthesis, transport and catabolism].
Kog Number: KOG1399 Score: 127 E_value: 2e-08
PFAM Definition: FMO-like, Flavin-binding monooxygenase-like. This family includes FMO proteins and cyclohexanone monooxygenase..
Pfam Number: pfam00743 Score: 120 E_value: 2e-07
Swissprot: Q00730|STCW_EMENI

Sequence:
>SY0AAD46YH10FM1
TTGGATCGAAGTCTTCATTTGCGAGCCTCACTATCTCTCCATAATGGCCC
CACCTCATGTCGATGATCAGTACTCTGCGGGCTCCACCTACCCACCAAAC
TGGATTCCAGTTGTGGAGAAACCCCTACGCACCCCGAAACGAAAACCAGT
TCAAGTACGGGGACTTTATGGACCACATTATCTATGAGAAAAACCATGAT
ATTGGCGGAACGTGGCTTGAGAACAGATACCCAGGGGTTGCCTGTGATGT
TCCTGCTCATATATACACCTTCTCATGGGAGCCAAATCCGGACTGGAGCG
AGTTTTACGTTGGCGGAGAAGAAATTTTCCAATACATGAAGCGTACAACG
GCGAAATACGACCTTGCAAGAGATGTTGTTTTCAATTCCAAGGTTGTGGA
AGCCATCTGGGACCAGGGGCGAGGTAAATGGGAGCTCAAGATTGAGCAAG
AGGGACGATTTATCTGGGACGAATGCGATATCTTTATAAACGCCTCAGGG
ATCCTGAATAAATGGAAGTTACCATCCATTGAAGGAATAAACGCTTTCAA
GGGACACTTGGTGCATAGTGCGAAATGGGAGGATACTTACGACTTTGC

Sequences in the Contig:

SY0AAD46YH10FM1