Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD27YM24FM1
Length(NT) : 655
Best Gene Model Blast : Link to GSTUMT00004391001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001211836.1| Score: 552 E_value: 5e-55
KEGG Definition: predicted flavoprotein involved in K+ transport
Accession: aor:AO090001000564 Score: 542 E_value: 4e-54
KOG Definition:
Classification: [Secondary metabolites biosynthesis, transport and catabolism].
Kog Number: KOG1399 Score: 145 E_value: 3e-10
PFAM Definition: FMO-like, Flavin-binding monooxygenase-like. This family includes FMO proteins and cyclohexanone monooxygenase..
Pfam Number: pfam00743 Score: 121 E_value: 1e-07
Swissprot: Q00730|STCW_EMENI

Sequence:
>SY0AAD27YM24FM1
TTGGTTCATATCGAAGTCTTCATTTGCGAGCCTCACTATCTCTCCATAAT
GGCCCCACCTCATGTCGATGATCAGTACTCTGCGGGCTCCACCTACCCAC
CAAACTGGATTCCAGTTGTGGAGAAACCCCTACGCACCCCGAAACGAGTG
AGAATTATTACTGTAGGTGCTGGGCATTCCGGATTAATGCTTACGTACAA
GATTAGAAACCAGTTCAAGTACGGGGACTTTATGGACCACATTATCTATG
AGAAAAACCTTGAGAACAGATACCCAGGGGTTGCCTGTGATGTTCCTGCT
CATATATACACCTTCTCATGGGAGCCAAATCCGGACTGGAGCGAGTTTTA
CGTTGGCGGAGAAGAAATTTTCCAATACATGAAGCGTACAACGGCGAAAT
ACGACCTTGCAAGAGATGTTGTTTTCAATTCCAAGGTTGTGGAAGCCATC
TGGGACCAGGGGCGAGGTAAATGGGAGCTCAAGATTGAGCAAGAGGGACG
ATTTATCTGGGACGAATGCGATATCTTTATAAACGCCTCAGGGATCCTGA
ATAAATGGAAGTTACCATCCATTGAAGGAATAAACGCTTTCAAGGGACAC
TTGGTGCATAGTGCGAAATGGGAGGATACTTACGACTTTGCTGGAAAGAG
AGTTG

Sequences in the Contig:

SY0AAD27YM24FM1