Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD21YJ02FM1
Length(NT) : 589
Best Gene Model Blast : Link to GSTUMT00000199001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein An12g00790
Accession: ref|XP_001395168.1| Score: 278 E_value: 3e-39
KEGG Definition: hypothetical protein
Accession: ang:An12g00790 Score: 278 E_value: 2e-39
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0548 Score: 325 E_value: 3e-31
PFAM Definition: No Hit Found
Swissprot: Q9USI5|STI1_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus

Sequence:
>SY0AAD21YJ02FM1
TTGGAGGGGGGGCTAGCGGATCCTTTGGGGACACAGAAATGCCAGACGCA
TCCGGGGCTCCACCGCCAAAGAAAGCTGCGACTCCGCCTCCAGAGCCAGA
GGACGAAGAGGCCAAGGCTAAGAAGGAGGCTAAGGAGGCAGCGGATAAGG
AGAAAGCGCTGGGTAATGAGAACTACAAGAAACGCAACTTTGACGCTGCT
ATCGAGCACTATGACAGAGCGTGGGAATTGCACAAGGATATCACATACCT
CAACAATCTCGCTGCCGCCAAATTTGAGGCAGGCGACTACGAAGGCTGCA
TAAAGGAGTGTGAGAGGGCTATCGAAGAAGGTCGTGAAATCCACGCCGAC
TTTAAACTAGTCGCAAAGTATCTCCCCCTTTCCCATTCCATCTCAGTTCA
GGCTAACAGATAACACTAGAGCCTTCGGCCGTATCGGCACCGCCCACCAA
AAACTTGAAAACTACCCCGCAGCAATAGATTACTACCAACGCTCTCTCAC
AGAACACCGCACGCCCGAAATTCTCCAGAAACTCCGCGCGGTCGAAAAGT
CCCAAGCAGACCGCGATCGTGTCTCCTACATCGACCCGG

Sequences in the Contig:

SY0AAD21YJ02FM1