Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD17YE20FM1
Length(NT) : 668
Best Gene Model Blast : Link to GSTUMT00012114001 E-value : 1e-90
Numbers of ESTs : 1

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE61634.1| Score: 554 E_value: 2e-64
KEGG Definition: molecular chaperone (HSP90 family); K04079 molecular chaperone HtpG
Accession: aor:AO090102000620 Score: 554 E_value: 1e-64
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0019 Score: 488 E_value: 4e-50
PFAM Definition: HATPase_c, Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase. This family represents the structurally related ATPase domains of histidine kinase, DNA gyrase B and HSP90..
Pfam Number: pfam02518 Score: 120 E_value: 2e-07
Swissprot: O43109|HSP90_PODAN

Sequence:
>SY0AAD17YE20FM1
TTGGCATCGTCTAGAGAAACACTCTCGACTTTTCTCAGAGCCCAATCAAT
TTCTCCTGCATCTCCTCATTCACCTCTCTATTTCCCTGCACCTTTAGAGA
TTCATAGACCCGAGAAGATAGCAAACAACCATTGCCATGGCTGAAACCTT
CGAATTCCAAGCTGAGATCTCTCAGTTGCTCTCCCTCATCATTAATACTG
TATACTCGAATAAGGGTACGGCTTTCGAGTCTGGGTTATTCCGGTTGTTC
ACAAACTTACTTTTGATTTAGAGATTTTCCTTCGAGAATTGATCTCCAAT
GCCTCAGACGCTTTGGACAAGATTCGCTACATTTCTCTTTCCGACGCTAG
CGTCTTGGAAGAGGAGAAGGATCTGAAAATTCACATTATCCCTAACAAGG
AGGCCAAGACTCTTTCAATTTTTGATACTGGTATCGGCTTTACTAAATCT
GATTTGGTAAACAATCTTGGTACCATTGCCCGATCTGGTACAAAGCAGTT
CATGGAGGCCCTGTCCGCAGGTGCTGATATCTCGATGATTGGTCAATTTG
GTGTTGGTTTCTACTCGGCATATCTTGTTGCCGATAAGGTTGAGGTTGTT
ACCAAGTCGAACGAAGATGAACAATACATCTGGGAGTCGGCTGCTGGTGG
TTCTTTTACTATCAAATT

Sequences in the Contig:

SY0AAD17YE20FM1