Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD11YJ24FM1
Length(NT) : 571
Best Gene Model Blast : Link to GSTUMT00004391001 E-value : 1e-145
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001211836.1| Score: 394 E_value: 8e-37
KEGG Definition: predicted flavoprotein involved in K+ transport
Accession: aor:AO090001000564 Score: 382 E_value: 1e-35
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q00730|STCW_EMENI

Sequence:
>SY0AAD11YJ24FM1
TTGGGGGGACAACTTTGTACAAAAAAGTTGGGGGGACAACTTTGTACAAA
AAAGTTGGGGGGACAACTTTGTACAAAAAAGTTGGGCCCAGGTGATACCC
TACAGTCTTCTTCATATCGAAGTCTTCATTTGCGAGCCTCACTATCTCTC
CATAATGGCCCCACCTCATGTCGATGATCAGTACTCTGCGGGCTCCACCT
ACCCACCAAACTGGATTCCAGTTGTGGAGAAACCCCTACGCACCCCGAAA
CGAGTGAGAATTATTACTGTAGGTGCTGGGCATTCCGGATTAATGCTTAC
GTACAAGATTAGAAACCAGTTCAAGTACGGGGACTTTATGGACCACATTA
TCTATGAGAAAAACCATGATATTGGCGGAACGTGGCTTGAGAACAGATAC
CCAGGGGTTGCCTGTGATGTTCCTGCTCATATATACACCTTCTCATGGGA
GCCAAATCCGGACTGGAGCGAGTTTTACGTTGGCGGAGAAGAAATTTTCC
AATACATGAAGCGTACAACGGCGAAATACGACCTTGCAAGAGATGTTGTT
TTCAATTCCAAGGTTGTGGAA

Sequences in the Contig:

SY0AAD11YJ24FM1