Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAC61YC07FM1
Length(NT) : 656
Best Gene Model Blast : Link to GSTUMT00003349001 E-value : 1e-120
Numbers of ESTs : 1

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: Tom22, Mitochondrial import receptor subunit Tom22. The mitochondrial protein translocase family, which is responsible for movement of nuclear encoded preproteins into mitochondria, is very complex with at least 19 components. These proteins include several chaperone proteins, four proteins of the outer membrane translocase (Tom) import receptor, five proteins of the Tom channel complex, five proteins of the inner membrane translocase (Tim) and three "motor" proteins. This family represents the Tom22 proteins..
Pfam Number: pfam04281 Score: 156 E_value: 1e-11

Sequence:
>SY0AAC61YC07FM1
TTGGCACCAACCACCTCAACCTCATCCTCCGCGAAAAACAACCCCAATTC
CTATCCGATAACAACAACAGCAACAATCTGCGAAAATGGTCGAACTCCGT
GAAGTAGAGGATGAGCACTTCGTCCACTCCCAACCTGCCCATTCCGACGA
CGAGGACTACACCGACACCGATAGCGAGATCTCAGAGGAGGACGAGGACG
ATGACGTCGACCTCGAGGAGTCCTTTTACGAACGGATCGCAGCGCTCAAG
GACATGATACCATTGAAGCAGAGGACCTACATTTCCAATGGCTTCTCAAG
GAGATGAAGATGACCCAGATAGCTACTGATGCACTCACCCCCGGCGCGGA
ATCGGTACTCACCACCCCGCAAAAGTAATCTCAGAAACTCTCCTGTACAG
AAAACACTTGCAATGTATATTATTTTTGGGGGGGTTCTATTTTTTTCGTG
TCTCTCTTGGGGATTAGATGGATGCTGGTCTGGTGGGGGGAAAGGTGGTG
TGGTATTCTCTCCTCTGTTACGTGCGGTTTTGGCTATTCAATGATGGGTT
ATGAGGTGATGATGTGTTGAAGCTATCAATGACCCCTTCCAGCGGTCCGG
GCTGCTTGGTATAGTAACACGCGATTGCAGTTCAATTCAGAGGTTGATCG
TTTGGG

Sequences in the Contig:

SY0AAC61YC07FM1