Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAC49YP03FM1
Length(NT) : 619
Best Gene Model Blast : Link to GSTUMT00003151001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_13912
Accession: ref|XP_001804113.1| Score: 182 E_value: 2e-16
KEGG Definition: hypothetical protein
Accession: fgr:FG09730.1 Score: 129 E_value: 3e-06
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAC49YP03FM1
TTGGAACATGGATATGGAGCTCTTTCGGGAGCTCAATGGAATTACGGAAG
AGAATACTGACTGCAGGGCAATCTTTCACGATGCCCGTGCTGATTTTATG
GACTTAATGTCGGTTGAGCGAAAGATGCTTGTTGTCAGAACGGCACTCAG
GCATCTAAGGGACTTTATGCACCCTCAGGTGTTAATAATGTCAGCAGAGC
ATGAGCACGGCTGGCTCAGTGCCACTATAACAGATACGGCGAAGAAATTA
CAGATGCCCGCGATTGAGCTCCCATGGGACGCCGCAGATGGCTTGAGATG
GATTACCAGGTTAGACAGTGGCTCTTTAAGCGGTAAGTTGCTTGTACAAG
CCTCGCTCTATCCCTCCCCTTGCGCGAAAAGAATTAGCTTACGAAATTTG
TGTTTATCTCTCTAGCATGGCATAAACCTAACTTCGAGATAGTCATACAT
GCAGACACTCACTCTGGAAACTTGGAACGTCTTCTCAAGTCTTTAGAGTC
TGCATTTTACCCGACTGCTCACCACCGACCCAAGAGCTTAACTGTTATTC
TCAATCCTTCTGTCCCTCTCCATCCCTTTACCAAATCATTCCTCTCAAGT
TACTCTTTCCCTTCCCCGA

Sequences in the Contig:

SY0AAC49YP03FM1