Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAC15YC24FM1
Length(NT) : 595
Best Gene Model Blast : Link to GSTUMT00007910001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: Ankyrin repeat protein
Accession: ref|XP_001259703.1| Score: 263 E_value: 1e-21
KEGG Definition: nucleoside phosphorylase
Accession: aor:AO090023000490 Score: 263 E_value: 7e-22
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAC15YC24FM1
TTGGGGGAAATGGACTTAGCGATGCCTACACGGCAACTCTCACCCGACTG
AAAGCCCAGAAGGGGGACAAATCAATACTCGGACTGAAGGTCCTGATGTG
GGTGTTATATTCGGAACGGCCATTAAAGGCCAAGGAACTGTGTCATGCCC
TAGGGGTGGAGGTGGGATCAACAGATCTAGATGTCGAAAATGTTCCTGCA
TTACGGACGCTCCTAGCATCGTGTCTGGGTCTCGTCACAGTTGAGGCGTC
TTCGTCCACCATTCGGCTGGTCCACTATACTCTGCAAGAACATCTCTCAA
CCCATCCAACACTATTCCATAGCCCCCACTCAACAATTGCTGAGGTTTGC
TTGACATATCTCAATTTTAAATGTGTCCGGGATATCTCGCCAATACGTGA
CTCGGCTCCCGCAACAATGCCACTTCTAGACTATGCTTCTTGTTACTGGG
GGGAGCACACGAGAAGGGGAATGACGGAAAATGTGAAAGCGCTTGCACTT
CGACTTCTGGATAGATTTGATGAGCATATAGCTGCTAAACTACTGTTATT
GCAAGATAATGGAAAACCTTACTTTTATTATTCCGAAGAACGAAG

Sequences in the Contig:

SY0AAC15YC24FM1