Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAC14YO13FM1
Length(NT) : 676
Best Gene Model Blast : Link to GSTUMT00005064001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_01537
Accession: ref|XP_001597343.1| Score: 471 E_value: 1e-45
KEGG Definition: hypothetical protein
Accession: fgr:FG05937.1 Score: 456 E_value: 4e-44
KOG Definition:
Classification: [Lipid transport and metabolism].
Kog Number: KOG3847 Score: 241 E_value: 2e-21
PFAM Definition: PAF-AH_p_II, Platelet-activating factor acetylhydrolase, plasma/intracellular isoform II. Platelet-activating factor acetylhydrolase (PAF-AH) is a subfamily of phospholipases A2, responsible for inactivation of platelet-activating factor through cleavage of an acetyl group. Three known PAF-AHs are the brain heterotrimeric PAF-AH Ib, whose catalytic beta and gamma subunits are aligned in pfam02266, the extracellular, plasma PAF-AH (pPAF-AH), and the intracellular PAF-AH isoform II (PAF-AH II). This family aligns pPAF-AH and PAF-AH II, whose similarity was previously noted..
Pfam Number: pfam03403 Score: 259 E_value: 2e-23
Swissprot: Q9URV1|PLG7_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus

Sequence:
>SY0AAC14YO13FM1
TTGGGTCGTTCCTATCACGCTTGAATTTGATCCCCCAATTCCCAACATAC
CCCGGCCCTTACCATGTTGGCTCATTCGAACTAGAGATTCCGGCATCGTC
ATTGGAGCCCACCTCCAAGCGGTCGCCACCAGATACTAAGGTCGAAACAG
TACAGTTTCGGGTTTTTTACCCAGCAGAAAAGCCCGATTCAGCAAATACA
ACGGGATGGTTTGGTAACACGGCAAAGAAATCCATCAGATGGCTTCCCGA
ACCATATCAACGGGAGTACCTGAGCGGCTACGCACGGTTTATGGGAGTAA
GCTCTAGGTTCGCGGAAATAGTTTCGTATCTTCCCCGAGCACTCTACTAC
ATTTCGTTACCAGCGACAGCCAATGCGCAGCTATTAGGGGGGAAACCACC
GGAGTTTAGATTCCCGACCATGGTTTTCTCGCACGGCCTTGGCGGAACGA
GGCTGGCGTATTCGCACATCTGCGGCTCCATCGCCTCCTATGGCGTGATT
GTGGTTGCGCCCGAGCACCGTGATGGAAGCGGTCCGGTGAGCTTCGTCAA
AGTGCCAGCAATGAAGGGCGCCCGCGTTTCTGGGGGAAAGTCTGAAGCAG
GAAAGCCTGATGTTAATGAAAGCTCTGCGAAGGCCCCAGTGAAGGACACA
AACGGGAGGATTCAAGTGGACTATAG

Sequences in the Contig:

SY0AAC14YO13FM1