Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAC12YI23FM1
Length(NT) : 115
Best Gene Model Blast : Link to GSTUMT00004235001 E-value : 2e-60
Numbers of ESTs : 1

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE56080.1| Score: 147 E_value: 2e-08
KEGG Definition: phosphoinositide phosphatase SAC1
Accession: aor:AO090005001111 Score: 147 E_value: 1e-08
KOG Definition:
Classification: [Lipid transport and metabolism].
Kog Number: KOG1888 Score: 119 E_value: 7e-08
PFAM Definition: Syja_N, SacI homology domain. This Pfam family represents a protein domain which shows homology to the yeast protein SacI. The SacI homology domain is most notably found at the amino terminal of the inositol 5'-phosphatase synaptojanin..
Pfam Number: pfam02383 Score: 123 E_value: 3e-08

Sequence:
>SY0AAC12YI23FM1
GCCTTCGTTACCTTCGCCGCGGGGTTGATGACTGTGGTAACGTCGCAAAC
TGCGTAGAAACTGAGCAGATCCTTTCCGACCCGGATTGGAATCGCGTTTT
CTCCCATGTGCAACT

Sequences in the Contig:

SY0AAC12YI23FM1