Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAC12YI05FM1
Length(NT) : 668
Best Gene Model Blast : Link to GSTUMT00000086001 E-value : 1e-126
Numbers of ESTs : 1

Blast Results:

Nr Definition: polyubiquitin binding protein (Doa1/Ufd3)
Accession: ref|XP_753799.1| Score: 194 E_value: 4e-26
KEGG Definition: polyubiquitin binding protein (Doa1/Ufd3), putative
Accession: afm:AFUA_5G08370 Score: 194 E_value: 2e-26
KOG Definition:
Classification: [Lipid transport and metabolism].
Kog Number: KOG0301 Score: 164 E_value: 2e-12
PFAM Definition: No Hit Found
Swissprot: P36037|DOA1_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0005634 = Cellular component: nucleus
GO:0043130 = Molecular function: ubiquitin binding
GO:0006303 = Biological process: double-strand break repair via nonhomologous end joining
GO:0006512 = Biological process: ubiquitin cycle
GO:0006511 = Biological process: ubiquitin-dependent protein catabolic process

Sequence:
>SY0AAC12YI05FM1
TTGGCTCACTTTTCCATCTCCACACCCCTAGTTACCCCTCTAAAGAAAGG
ATCAATGGCTAGTATATACAAGCTTACCGCAGCTCTACGGGGCCACGAGG
ACGATGTGAGTAGCTCCGGGCTCTTGTATCAAATTCTGTTTTTTGATCCC
CGAGTTTGCTGAGAAAGGAAAAAAACTACGTGGAATGCCTAACCCCCATT
TATCCAGGTTCGCGGTGTCGTTTTCCCTTCTCCTTATTTTGTGACTTCTG
TATCTCGAGATGCTACTGTTCGACTATGGAAACGTGAAGATTCCGATGGG
ACTGTCTTCTCGGACCACATCAACTCGACTGGCTCCGGATTCATTAACAG
TGTTACTTTCATTCTTCCAACGGAGGAGCATCCTAAGGGTCGGTAGTTTC
CTGATATGTTTTAGGGCTAAAAATTAATTAGTGGGTTATTTAGGTTTGGT
TGTTAGTGGAGGCCAGGACACCATCATCGAGGTTCGAGAACCAGGCTCCA
AAGATACAGACGATGCAAAGTACCTGCTCTTAGGTCATACGCATAATGTT
TGCGCGTTGGACAATTATGCGGGCATCATAATTTCGGGATCCTGGGATGG
TACAGCACGTGTGTGGAAAAACTGGGAAAGCCAATATGTGTTAGACGGCC
ATGACCAGGGAGTGTTGG

Sequences in the Contig:

SY0AAC12YI05FM1