Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAC12YH05FM1
Length(NT) : 630
Best Gene Model Blast : Link to GSTUMT00003404001 E-value : 1e-157
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_11762
Accession: ref|XP_001802000.1| Score: 240 E_value: 2e-31
KEGG Definition: predicted protein
Accession: aor:AO090120000078 Score: 190 E_value: 4e-21
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG0507 Score: 108 E_value: 5e-06
PFAM Definition: No Hit Found
Swissprot: P53066|YGZ2_YEAST

Sequence:
>SY0AAC12YH05FM1
TTGGCGTGCGCACGGTAGACTACGCTTGCAAACAACAACGACAGCAACAG
CAGGAACAAAGAGAAGTAGAAGAATAAGGCTAGATCATGGCTGCGATTTC
TCGAGGGGCTGAAGAGGAGGGTGCGTCCCTAAAAGAACTCCTGCTCGAAT
CCGCCCGGCGAAATAATACCGACCTCCTCGAAGAAGTTATTTCAGAGGGC
GCTTCCGGTCTCGCTGATCTGTTAAATAATACCCGAGACGGGGTTGGTAA
TACTGCTGTTCATCTTGCGGCGAAAAATGGCTCTCGTACGCCCCCCCACC
ACCATCCCCTGCTGGAGGCTAATAGTTTAATTGTGGGTGTGCGGGTGAGT
AGTGGAAGTACTGGACTTGCTCCTCGACCAAGAAGGCCTAGAAGTCGACC
CACTGGACAGAATGGAGAAGGAAACTCCTCTTCATAAGGCTGTTTTATAC
GCAAAATCTCGGGAGGAGGGTGGATTGGAGGTGGTGGAGATGCTGATCGA
TGCTGGGGCTGATCCTAGGATACGGAACAAAGCCAAGCAAAGACCTGTAG
ATATTGTCGACCCAAGAGATACCGAGCTACGCGTTGTGCTGCAGAAAGCG
GAGTACCTCATGACGGCTGGGGGTGATATT

Sequences in the Contig:

SY0AAC12YH05FM1