Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAC12YD19FM1
Length(NT) : 621
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein DR_0254
Accession: gb|AAF09840.1|AE001886_6 Score: 131 E_value: 2e-15
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAC12YD19FM1
TTGGACTGTTATGGCTAGGGGGTCATTGCGACTTACCAAACCATTGCAAA
CTCCGAATACCGATGAGTGCGAGCTTGGGAGACAGACGTCGGGTGCTAAC
GTCCGGCGTCAAGAGGGAAACAACCCAGACCGCCAGCTAAGGTCCCAAAG
ATTGGCTAAGTGGAAAACGAAGTGGGAAGGCTAAAACAGTCAGGATGTTG
GCTTAGAAGCAGCCATCATTTAAAGAAAGCGTAATAGCTCACTGATCGAG
TCGTCCTGCGCGGAAGATGTAACGGGGCTAAGCCAGTCACCGAAGCTGCG
GATATTGTTCTGTGATTTATCACAGATATATATGGTAGGAGAGCGTTCTG
TAAGCCTGCGAAGGTGTCTTGTAAAGGATGCTGGAGGTATCAGAAGTGCG
AATGCTGACATGAGTAGCGATAATGGGGGTGAAAAGCCTCCACGCCGTAA
GCCCAAGGTTTCCTGTTCAACGTTCATCGGAGCAGGGTGAGTCGGCCCCT
AAGGCGAGGCAGAGATGCGTAGCTGATGGGAAGCAGGTTAATATTCCTGC
ACCGTCGTATGATGCGATGGGGGGACGGATCGCGGAAGGTTGTCTGACTG
TTGGAATAGTCAGTTTCTGTC

Sequences in the Contig:

SY0AAC12YD19FM1