Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAC12YD08FM1
Length(NT) : 624
Best Gene Model Blast : Link to GSTUMT00007009001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: autophagy protein Atg13, putative
Accession: ref|XP_001272723.1| Score: 414 E_value: 5e-39
KEGG Definition: autophagy protein Atg13, putative
Accession: afm:AFUA_2G04770 Score: 411 E_value: 5e-39
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG4573 Score: 219 E_value: 6e-19
PFAM Definition: No Hit Found
Swissprot: Q4WHN5|ATG13_ASPFU

Sequence:
>SY0AAC12YD08FM1
TTGGGTAGTTCAATATCGAGCTTGACGAGACGGATGCCTTTCGAAGGGAG
TTGGATTTGTGGCGGTATGGAGACTCGTTCGAACCGCGACCTCCACCGTT
AATTATTGAGACTTATCTCGATACCAGAGATCTGACAGCGAACCAATCCT
TGGTGATTTTAGATGCCGATGGAAAGAAATGGAATGTGGACGAGGCCACG
GACGCGGCCGCGGCCCGAGCTGGATTGAATGCGGAACCCCGAAGAAGTGT
GCGCGGGGGGCCCGCTAGACACGAAGTAATATTGGAAAGGTGGACAGTAG
AATTGGGTGCTCCGTTTGACGTCGCGCTTGCTCCAGAGCTCCCCGTTGTT
TATAAGAAAGGTATAGTAATGTTTCGTGCATTGTATACATATGCCGGGCT
TATGCCTACTTGGAAATTTCGTCGGCGGTTGTTGAGATCCAAGCTCAACC
CGAGCCCGCTGAAGGTTAATTGTCGAGTCATCAATGGGAATGACTATTCA
CACACCCCGAAGGATTTTGATCTTTTGTATGTGCCGTTGTGTCAAGGCGA
GGGCAACGTTGTTGAGACGTATCAGATTGAGAAAGTGGACAGTCCGGCAG
GTTCTATCAAAGTTCGCGTTTCTT

Sequences in the Contig:

SY0AAC12YD08FM1