Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAC12YC22FM1
Length(NT) : 670
Best Gene Model Blast : Link to GSTUMT00003482001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_09627
Accession: ref|XP_001552397.1| Score: 168 E_value: 2e-10
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAC12YC22FM1
TTGGAGCGGATGTGCGGAGGAAAGCCAGGGAATTGAGTGCAAAATCCAAA
ACCCTCGACCTGGACTTGGAAATCTCGCAGTCCAAAATCAACGACTTGGA
TACAGAACTCACATCGCTGAAAAGGCAACTGGAAGAGCTCAAGAAAGAGC
ACACGGAGGAGATTTCTGCACTGGGCCTTACATTTTCCAGAGAACGGGAG
AGCTGGCAGAAGGAGCTACAGGCACGGCTAGAAGAAGAGCGCACAAAATG
GATTGAAGCCTCTCGCGCTTTCTCATCGCCACCTCAAGCTCCACTTCTAC
CCCCTACGTCTGCGCATTCGATAAGGAAGTTCTCGGGCCCATTATCCACC
AGTGAAAGCTACTTCCTAGGTTCTAATAATAACAACCATCGCAAAAACTC
CCGCTCTCCGGGGCCCTCGGAAACACCAACTACTCCAGAGGGCCTGGGTT
TAGTCGCCCCACCCGCGGGGCAACTGCCACTGCCATCCCATCGAGGCTTT
AGCACCCCTCCACTCTCTATCCGCCAGGACTCCCTGCCAATCCACAACTC
CCCATCCCGTGCCTCCCCGCAAAACACCATCAGCACGACACAACTAACCA
CCGACCCAGAGCAAGAAGACCTCGACCCCGTCCCCGTCGACTTCTATGAG
ACCCCCATAAACCCCACCAC

Sequences in the Contig:

SY0AAC12YC22FM1