Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAC12YA11FM1
Length(NT) : 702
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_09374
Accession: ref|XP_001552033.1| Score: 842 E_value: 1e-88
KEGG Definition: predicted protein
Accession: aor:AO090005000724 Score: 687 E_value: 7e-71
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0509 Score: 136 E_value: 3e-09
PFAM Definition: No Hit Found
Swissprot: Q505D1|ANR28_MOUSE

Sequence:
>SY0AAC12YA11FM1
TTGGCCTGAGCGGAGGGTTTGAGGAAGAGAAACCCAAACGGCCGAGGGAA
CTCCCAGATGACCTGCCAAAATCACTCGAAGACCGCAGAAATGTCCCAGC
ACATTATACAACAGAGACGGAGATGTATGATGCGTGGCAAGGACAGTCAC
AATTCCTGACGGCTCCCGTCCTCGCCAAACCATTGCAATTCAACAGCCTA
ACCCTTGACGACGATGGTTTCGAAGATGATCTGGCTACGCAGAAGATTGA
GGACAGTGATAGCAGGTTGATGGAAATGCTGGCTGCCCAGGGACGACATC
GGGATGGATCTGCGAGCGAAGATGAAGACTCAGTAGCAAAGAGCGAGAAA
CTGTCCGAGGACGAAAAGAAAGATATCTTGCAGAAGGCGCTTACCATGGC
TGCGAGCAATGGCGATATGGAGAGAATAGAGAGGATTCTGAACGGGCCTG
CAAAGGATTTTGTGGATGTTGATGCACCAGATGAGGAGGGGACTGCCCCT
CTAATATACGCTAGTTGCTTTGGCCATGAAACAGTTGTGACAGCACTCCT
TAATGCTGGTGCAAATGTCGATAAGCAAGACAGAAACCAATGGAGTGCAC
TTATGTGGGCCATGACCAACCGCCACAAGGGAATTTCGAAAGCGCTTTTG
GATCATGGAGCTTCTTCTACAGTGAAATCATCCTCTGGCCGCACTCGGAC
TG

Sequences in the Contig:

SY0AAC12YA11FM1