Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAC11YN22FM1
Length(NT) : 664
Best Gene Model Blast : Link to GSTUMT00003206001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein FG01614.1
Accession: ref|XP_381790.1| Score: 159 E_value: 2e-09
KEGG Definition: hypothetical protein
Accession: fgr:FG01614.1 Score: 159 E_value: 1e-09
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAC11YN22FM1
TGTACAAAAAGTTGGGTTTCAATACTTGTACATTAATGGGTACCCTGTGC
CTATGGGGACGACCTTGCTGCATGAGGAGATCAATCGGTTATTTGCTGCT
TCCTCTTTTGGCGTGGTAGAGGAGGACGATGGAACAAAAAGGCTGAGGGG
TAATCCGAAGAAGGGTGCCGATAGGTGGGCCATGTTTGTACTGCGTGTCG
AATGTCAGCGACGAGAAGTGGATGTCATAGGTGGTGAAGGTGGGACAAAA
GGGAAAGCCGGGCTGGAGGGTGATAATCTTAGTGCCACAATCGGGCTTCT
GCAAAGGCTCATTCATGAATTCCTGAGAACTCATTATTTCCGCTCCACCC
TAGCGACGGCTACGAAGCCCCAAAGGGGCGAAGGGACCACAATTCGTGCA
TCCCCCCAATCGGCATTAGATCTTCTGGGCGAGTCCCGGCCAAGAACACC
ACTGGGTGTCCTCCGCAGAAATACCAATACAGCATCGTCTCAAACAAAAG
ACACCGGAAAATTGACAAAAAGTAGAGACCTCGGAGTATTGGCAAGCTGG
AGCAGAGTCAAATCCGCCCGAGCCGATCCAAGGGAAGAAGAAGGCAGACA
GGGTCCGGGATTTTCAAAAGCGCTTACCTTCTCACCCGCACCCCTCCCTG
CTGGATCTCGCCTG

Sequences in the Contig:

SY0AAC11YN22FM1