Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAC11YF15FM1
Length(NT) : 666
Best Gene Model Blast : Link to GSTUMT00010023001 E-value : 1e-160
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001211602.1| Score: 206 E_value: 2e-20
KEGG Definition: conserved hypothetical protein
Accession: afm:AFUA_2G15580 Score: 198 E_value: 9e-20
KOG Definition: No Hit Found
PFAM Definition: DUF1753, Golgi protein of unknown function (DUF1753). This is a family of Golgi proteins of unknown function..
Pfam Number: pfam08552 Score: 191 E_value: 1e-15

Sequence:
>SY0AAC11YF15FM1
TTGGCACCACTGTCACCTCTACCACCATCACTACCAAAAACCCTCATAAC
AAACTACGGTGAGCAGTACCTTGAGATCTGCACCCTCCCTGGAATTTAAA
GAGATGGTTCTGTTACTCCGCTTTCTGCGGATGCCGCGGCCAACGGTTTG
TTTGTTTGTTTGAGTTTTCTCCGCTTTTTGCCCGTTGATGCTAATTTTTT
GTAGCACTTCCTTGGACTTTTAGACCTCCAGCATGGGAGCCGAGCTCATT
CTTGTGTGTACTCTTTTCAATAAAATCTCCGGTTTGTACGGTATTATAGC
CATGCTTGTAGGTACGTTATGCTCTCTTTTGCTCTCGTCCCTTCCCCTCC
AGCCCCACACTTTGTCTAACTTGATGCCCGCGCAGGAGCCGAGATATCTA
CGCTGCAACTATCGATGTACTTTTACTCCCTTTTAATGTTCGGAGCGTTA
ATCTATACTCTCCCGAAACTCCATCAACGAAACCCCCTCGCCGCCATCAC
GTTTGCATACCTGTACCTGGCCGATTCTCTCATAAACGCCCTTTACACTC
TCCTCTTTGGAATATCCTGGTTTTTGGTCTTGGCCTCGAAACACAACTCC
GCTATCCACCCGATAAAGTCTGCTGGTGAGACGATGGATGACACCGCTGG
CTTCACACCCTCTGAA

Sequences in the Contig:

SY0AAC11YF15FM1