Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAC11YF14FM1
Length(NT) : 683
Best Gene Model Blast : Link to GSTUMT00009764001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001243805.1| Score: 660 E_value: 2e-67
KEGG Definition: WD40 repeat protein
Accession: aor:AO090003000490 Score: 653 E_value: 6e-67
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG1273 Score: 445 E_value: 4e-45
PFAM Definition: No Hit Found
Swissprot: O42858|SWD1_SCHPO
Gene Ontology:
GO:0000785 = Cellular component: chromatin
GO:0048188 = Cellular component: COMPASS complex
GO:0005829 = Cellular component: cytosol
GO:0006338 = Biological process: chromatin remodeling
GO:0051568 = Biological process: histone H3-K4 methylation

Sequence:
>SY0AAC11YF14FM1
TTGGCTGCGCTGAACTTCACCCGAAAAACCCGAACATTTTTGTTTGCGCC
CTATTCGAAGATTCACCTTACCTTGTAGATATATCCGACCATGTGCCGAG
AAAATACCAGCTTACAAGTGCACCCAAGCGACCGCTACAGCCGGGCGCAG
AGGAAGGAGAAATTGATGAAAAGCGGGCTGCAGCTGATGCAAAACAAATG
ACTACCGCATCTGTATTCACTGCTACTGGTGACCATATTATTACTGGATC
CAACAAAGGCTGGGTGAATGTGATCTCCACCACAACGAAGGAGATGATTC
ATTCCACCCGGGTCACCTCTGGCTGTATTACTTACATTAGGCTCACAATG
TCTGGTAGAAACATGGTCGTAAATGCTAATGATCGGGTCTTGAGGTCCAT
CAATATCCCAGATAATCTTAAAGAGGGTGTTGATGGTAACGACGTTCGAC
TTATCGTAGAGCACAAGTTTCAAGATGTCGTCAACAGGCTGCTATGGAAT
CACTGCACCTTTTCTGGAAACGGCGACTACCTGACTGCCACAACTTTTAA
AAACCATGACATCTACATCTGGGAAAGAAGCATTGGTGTTCTCGTCAAAA
TCTTAGAAGGCCCAAAAGAAGAACTGGGCACAGTAGAGTGGCATCCAACC
CGCCCCCTCATCGCCGCGACTGGTCTCGAGAGC

Sequences in the Contig:

SY0AAC11YF14FM1