Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAC11YE02FM1
Length(NT) : 555
Best Gene Model Blast : Link to GSTUMT00002706001 E-value : 8e-64
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CIMG_04521
Accession: ref|XP_001245080.1| Score: 312 E_value: 2e-27
KEGG Definition: hypothetical protein
Accession: ani:AN4487.2 Score: 293 E_value: 2e-25
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAC11YE02FM1
TTGGCAAGGATTGACATTTTGCACCGACATGTCCAATAACCATTAAAACC
CTTTTCCCGCAGGCCTCGACAAGCAGGAGGAAAAGGATCCTTCCTCCTAC
CTACCTACCACGGACCAATGCATCATTCACCTAAAGCTCCTGGCATGCTT
CCACAAACTCCGCTTGCAGATATCGGCGGTGGATAATTTATTTGGATACC
CGGACATCGTCGTTACCAATGAAGAGACAAAGAAACGCCAAGCGGGTACC
AAGGAAAAGCGATGGGAAGTATACGTTGTGAGGGCAGTGGAGAGGTTCAC
TCGGTGGTGGCATATACTTTACAATTCCAAGTTCGGGAGATTTGAGGAAG
GGATAACGGGCCATAATGCTGTGCGGAAAGCCCAGGTGTTTGATGAGGTG
TTGGATTCGAACATAGTGTTTGGTACTGACGCTATGCCGCCGCTGGATGT
GTTGATGGTATGGCACGCATTTATCCTGAATCCGAGATGTTTCTTGGAAG
ACTGTTATAGGGTCGGAAAGATTGATTTCTGGAGGGCGGGTTTGCCGTGG
AGTGT

Sequences in the Contig:

SY0AAC11YE02FM1