Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAC11YD03FM1
Length(NT) : 521
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CHGG_03789
Accession: ref|XP_001223003.1| Score: 302 E_value: 3e-26
KEGG Definition: hypothetical protein
Accession: ncr:NCU05224.1 Score: 283 E_value: 2e-24
KOG Definition:
Classification: [Signal transduction mechanisms, Cytoskeleton].
Kog Number: KOG4203 Score: 183 E_value: 7e-15
PFAM Definition: PRK, Phosphoribulokinase / Uridine kinase family..
Pfam Number: pfam00485 Score: 192 E_value: 5e-16
Swissprot: O74427|URK1_SCHPO
Gene Ontology:
GO:0000935 = Cellular component: barrier septum
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus

Sequence:
>SY0AAC11YD03FM1
TTGGCTTCAAGTTTTGTTTTCTTTATTCAATAATACCTCATTCCTATTAT
TGTTTCCTACTTCTTCTAGCTGCCTTATGATGCTGCCTATATAAAACCTC
TTCTTCCTGGCCAACCTTAGGATATTTCGTCTTGTTGGCATTCTCCCTCC
ATCTCTCCACAAGTATGGGCACTTCGGAGGTAGCTGCTCGAGCTCATTAC
TCGCCGCCATGGGCCGACGTCTCGATCATTGGTATTGCAGGTAGCTCTGG
ATCCGGGAAATCGACGTTGTCTCATGCCATTGTATCACAATTAAATCTTC
CCTGGGTAGTAATTTTGTCCATGGACTCTTTCTACAAAACTCTCAATGAG
GAAGCCTCGCGGAAAGCATTCAGAAATGAATATGATTTCGACTCTCCTGA
CGCCATAGACTTCGACGTCCTCGTCGATCGACTTCGAGATCTGAAAGCTG
GGTAAATATAGCCAGCATCATTCTCTCCTTGGCCATTTCCGATGCTATAC
TCGGATTCTTGGCTAACGCAT

Sequences in the Contig:

SY0AAC11YD03FM1