Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAC11YD02FM1
Length(NT) : 609
Best Gene Model Blast : Link to GSTUMT00008310001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_12982
Accession: ref|XP_001803196.1| Score: 545 E_value: 3e-54
KEGG Definition: hypothetical protein
Accession: ang:An17g00320 Score: 541 E_value: 4e-54
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG1032 Score: 335 E_value: 2e-32
PFAM Definition: GRAM, GRAM domain. The GRAM domain is found in in glucosyltransferases, myotubularins and other putative membrane-associated proteins..
Pfam Number: pfam02893 Score: 171 E_value: 2e-13
Swissprot: Q06681|YSP2_YEAST
Gene Ontology:
GO:0005739 = Cellular component: mitochondrion
GO:0006915 = Biological process: apoptosis

Sequence:
>SY0AAC11YD02FM1
TTGGGGAAAACACCCATGGCGGAAGATTCCGCCTTTACGGGCCGAGACGG
CGATCATGCCCCGGAGAAGGGTGTTTTGAATCCTCCCGATGATCGAGATG
ACACCTGGTCTGGCGATGCCGACCGGCGGAGATCTGGAAGTGTGAGGAGC
GGTGGCCGGCGGAAACGTGGGTCGTCTGCGGCTTCCGGAGCAAACCCGCA
GCCGGTACCCAGACCTACCGGGTTCGCTGTCGCGCCTAAGAGGCGTAACC
GCGAATTCCATGAGATGTTTAGGTCTGTGCCAGAGGACGATTATCTGATA
GAGGATTACGGATGCGCTTTACAAAAGGAAATCTTGCTTCAGGGCAGACT
GTACGTCTCCGAAGGGCACATATGCTTTTACTCCAATATTTTCGGATGGG
TCAATACTCTGATTATCAGCTTTGATGAGATTGTCAGCGTTGAGAAGAAG
AATACTGCCATGCTGTTTCCCAATGCCATTGTTATTCAGACGCTCCATGC
ACGAAATGTCTTTGCAAGTTTTATATCTAGGGACAGTACATATGATCTTA
TTGTTGGTATCTGGAAGATCGGACATCCGCAACTTGTTGCCGGCGCTACT
GGGGTTAGG

Sequences in the Contig:

SY0AAC11YD02FM1