Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAC11YC24FM1
Length(NT) : 512
Best Gene Model Blast : Link to GSTUMT00010611001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE59667.1| Score: 155 E_value: 3e-09
KEGG Definition: predicted protein
Accession: aor:AO090026000180 Score: 155 E_value: 2e-09
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAC11YC24FM1
CGTGGCTTTGAGTGGAGGTACTCTGAAGTATTTTACCTGCCCCGAGACCT
AGATTTTGAACTCAAGGACAAGGGCCACAGGCTTCGACTTTTAAAAGCGT
ACTACACAAATTACGTTTCGGACCATGTGGGGAAATATCTCGATTTGGAG
CCGGGGAAGCAGCCGAAGTTTTCGCGTTGCGAAAAGAAGATTGATTCCGT
CAACCTATGTTTCGGAACTATCGAGGATGCGCAAGGTCTCCTCCGTCATA
TAGCCGATAGATGGGAACTAAAGTTCGCCCGCCAAATCGCCCGTGTATCC
TACAAACCGACGAACCAAAGGTCCTTCTTCCGGGTAGCCACCTCCTCCGG
CTTCGGCCCGGCGGATCTCTCACTGTGGAAGAGAGGAGACACGCAACGCT
TGGTCATCCGCAGATCCTCGCCCTCCTCTTCCGCAGAACTATACCTAACG
GCCGTTCTACGTATGGATTTCGACCACGATTTTGAAAAGATGGTGATAGA
AAAGAACGTGGA

Sequences in the Contig:

SY0AAC11YC24FM1