Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAC11YC21FM1
Length(NT) : 616
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein FG11466.1
Accession: ref|XP_391642.1| Score: 409 E_value: 2e-38
KEGG Definition: hypothetical protein
Accession: fgr:FG11466.1 Score: 409 E_value: 9e-39
KOG Definition:
Classification: [Signal transduction mechanisms, Cytoskeleton].
Kog Number: KOG3671 Score: 199 E_value: 1e-16
PFAM Definition: Atrophin-1, Atrophin-1 family. Atrophin-1 is the protein product of the dentatorubral-pallidoluysian atrophy (DRPLA) gene. DRPLA OMIM:125370 is a progressive neurodegenerative disorder. It is caused by the expansion of a CAG repeat in the DRPLA gene on chromosome 12p. This results in an extended polyglutamine region in atrophin-1, that is thought to confer toxicity to the protein, possibly through altering its interactions with other proteins. The expansion of a CAG repeat is also the underlying defect in six other neurodegenerative disorders, including Huntington's disease. One interaction of expanded polyglutamine repeats that is thought to be pathogenic is that with the short glutamine repeat in the transcriptional coactivator CREB binding protein, CBP. This interaction draws CBP away from its usual nuclear location to the expanded polyglutamine repeat protein aggregates that are characteristic of the polyglutamine neurodegenerative disorders. This interferes with CBP-mediated transcription and causes cytotoxicity..
Pfam Number: pfam03154 Score: 172 E_value: 1e-13
Swissprot: Q01589|SED1_YEAST
Gene Ontology:
GO:0009277 = Cellular component: fungal-type cell wall
GO:0005739 = Cellular component: mitochondrion
GO:0005840 = Cellular component: ribosome
GO:0005199 = Molecular function: structural constituent of cell wall
GO:0007047 = Biological process: cell wall organization and biogenesis
GO:0000002 = Biological process: mitochondrial genome maintenance

Sequence:
>SY0AAC11YC21FM1
TTGGTCACTCTCCAACCTCACCTCTCTCTCAACTCCTCAACCCACTTCCA
ACTTTCGTTTAAACAACACCACAACACAACCATAAAAATGGGTTTCAGCA
CTCGAGTTGCCCTTGTGGGCTCCGTCCTGGCCGCCGCTGCCAACGCCTCT
CCCAACTACTACGGTGCTCCCGCCAACACCACCGGTGGAGTTGTCTACAC
CACCGAGGTCGTCACCTCGCTGACCACCTACTGCCCTGCCGCCACCACCC
TCACCTACGGCGACAAGACCTACACCGTCACCGAGGCCACCACCCTGACC
ATCACCGACTGCCCTTGCACCGTCAGCAAGCCCGTCTACACCAAGACCTA
TGCTCCCCCTGCTTCCTCCTCTGCTGCCTCTACCTGCCCTGAGGAGTGCT
ACGATGCCTACAACAAGTGCCGCACCGGTCCCGATGCTAACATGGCCACC
TGCGCTGCTGAGTATGCCTCGTGCCTGGGCTTCAACCCCTTCGGTGATGA
CGGCTCTCTGGTCACTCCCACTGCCTGCTCTTCCAAGACTGCCTACACTC
AGCCTCCCGTTTACACCACCGAGGTTGTCACTGCCATCACCACCTACTGC
CCCGAGGCCACCACTC

Sequences in the Contig:

SY0AAC11YC21FM1